|
PackGene Biotech lnc
plv lenti efs hspcas9 u6 sgrna Plv Lenti Efs Hspcas9 U6 Sgrna, supplied by PackGene Biotech lnc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/Custom+sgRNA/pmc09184653-291-9-13 Average 94 stars, based on 1 article reviews
plv lenti efs hspcas9 u6 sgrna - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Addgene inc
paired guide rna pgrna library pool library pool ![]() Paired Guide Rna Pgrna Library Pool Library Pool, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/Human+paired-guide+RNA+(pgRNA)+Library+for+long+non-coding+RNAs+(lncRNAs)(Pooled+Library+%2389640)/pmc11522894-28-2-9 Average 92 stars, based on 1 article reviews
paired guide rna pgrna library pool library pool - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Addgene inc
cdr1as sequence ![]() Cdr1as Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/dSa+Cdr1as+guide+RNA+(Plasmid+%2399681)/pmc06754938-61-5-17 Average 93 stars, based on 1 article reviews
cdr1as sequence - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
GenScript corporation
mouse non-targeting grna (guide rna) sequence ![]() Mouse Non Targeting Grna (Guide Rna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/mouse+non+targeting+grna++guide+rna++sequence/pm33197448-108-8-28 Average 90 stars, based on 1 article reviews
mouse non-targeting grna (guide rna) sequence - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
crispr guide rna (grna ![]() Crispr Guide Rna (Grna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/crispr+guide+rna++grna/pm37989866-245-0-13 Average 90 stars, based on 1 article reviews
crispr guide rna (grna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
guide rna (grna) designing tool ![]() Guide Rna (Grna) Designing Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/guide+rna++grna++designing+tool/bio_rxiv__2021__06__17__448791-160-5-7 Average 90 stars, based on 1 article reviews
guide rna (grna) designing tool - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
guide rna (grna) sequences targeting the exon regions of the human il15ra gene ![]() Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/guide+rna++grna++sequences+targeting+the+exon+regions+of+the+human+il15ra+gene/pmc11986442-68-6-17 Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Applied StemCell Inc
guide rna (grna) prnp-g2 ![]() Guide Rna (Grna) Prnp G2, supplied by Applied StemCell Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/guide+rna++grna++prnp+g2/pm36301953-87-15-6 Average 90 stars, based on 1 article reviews
guide rna (grna) prnp-g2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
guide rna (grna) sequences ![]() Guide Rna (Grna) Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/guide+rna++grna++sequences/pm39396119-44-2-23 Average 90 stars, based on 1 article reviews
guide rna (grna) sequences - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) ![]() 20 Bp Guide Rna (Grna) Sequence (5′ Catggagttcccgttcgatg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/20+bp+guide+rna++grna++sequence++5++catggagttcccgttcgatg+3++/pmc11105004-138-2-19 Average 90 stars, based on 1 article reviews
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
lentivirus encoding a guide rna (grna) for gpr137b (cgtgaagctcggcctcaccg) ![]() Lentivirus Encoding A Guide Rna (Grna) For Gpr137b (Cgtgaagctcggcctcaccg), supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/lentivirus+encoding+a+guide+rna++grna++for+gpr137b++cgtgaagctcggcctcaccg+/pmc06708790-199-0-17 Average 90 stars, based on 1 article reviews
lentivirus encoding a guide rna (grna) for gpr137b (cgtgaagctcggcctcaccg) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
20-bp guide rna (grna) sequence ![]() 20 Bp Guide Rna (Grna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+grna/20+bp+guide+rna++grna++sequence/pmc11105004-74-7-27 Average 90 stars, based on 1 article reviews
20-bp guide rna (grna) sequence - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Blood
Article Title: An unbiased lncRNA dropout CRISPR-Cas9 screen reveals RP11-350G8.5 as a novel therapeutic target for multiple myeloma
doi: 10.1182/blood.2023021991
Figure Lengend Snippet: lncRNA dropout CRISPR-Cas9 screen in MM cell lines. (A) Schematic representation of the CRISPR screening pipeline. (B) Spearman's correlation between pgRNA read count profiles (from DNA collected 30 days after transduction and selection of the library) across screen replicates = 0.85 and 0.88, respectively, for AMO-1 and ABZB, with color bars on top/left indicating cluster membership obtained via hierarchical clustering (complete distance method). (C) Representation of pgRNA abundance log fold changes (logFCs) in DNA collected 30 days after library transduction and selection vs plasmidic amounts for 3 groups of pgRNAs: nontargeting (negative controls [median logFC = 0.27 and 0.35, respectively, for AMO-1 and ABZB]), targeting ribosomal protein genes (control essential genes, median logFC = −0.68 and −0.43, with a logFC ≤−0.5, corresponding to a MAGeCK FDR ≤20%), and lncRNAs, across the 2 screens. Each point represents 1 of the 12 472 pgRNAs in the library with coordinates on the y-axis indicating the median logFC across screen replicates. (D) Gene-wise MAGeCK robust rank aggregation (RRA) scores for significant dependencies identified in the 2 screens at an FDR ≤20%. Top essential control genes, dependencies that are private to each cell line and shared across them (as per the color scheme) are highligted. (E) Number of significantly essential lncRNAs (at an FDR ≤20%) in the 2 screened cell lines and their overlap. MOI, multiplicity of infection.
Article Snippet: The human
Techniques: CRISPR, Transduction, Selection, Control, Infection
Journal: Blood
Article Title: An unbiased lncRNA dropout CRISPR-Cas9 screen reveals RP11-350G8.5 as a novel therapeutic target for multiple myeloma
doi: 10.1182/blood.2023021991
Figure Lengend Snippet: Functional validation of prioritized oncogenic lncRNA candidates. (A) RP11-350G8.5 and LINC00467 basal expression levels via quantitative real time PCR (qRT-PCR) in MM cell lines and peripheral blood mononuclear cells (PBMCs) from healthy donors (values are normalized to the expression of GAPDH). (B) Representative image of genomic PCR products before and after KO of LINC00467 and RP11-350G8.5 in AMO-1 cells, visualized on 1.5% agarose gels. On the right: Sanger sequence of the amplicons encompassing the CRISPR-targeted region. Blue rectangles highlight pgRNA binding sites, whereas colored lines refer to the schematic picture of the KO reported above the gel picture (on the left). (C) Representative image of flow cytometric monitoring of AMO-1 and ABZB cells transduced with a SCRAMBLE-GFP-CRISPR vector (dark gray) or LINC00467/KO-GFP-CRISPR vector (light blue) or RP11-350G8.5/KO- GFP-CRISPR vector (red). Light-gray curves represent the percentage of viable cells at day 0 (48 hours after lentiviral transduction) with overlapping colored curves at day 20. (D) Representative images of colony assay of AMO-1 and ABZB GFP-sorted cells, 15 days after plating, were generated using EVOS XL-Core microscope (Invitrogen by Thermo Fisher) (magnification ×10). (E) Number of colonies in 3 independent wells. (F) Dose-response curves 24 hours after treatment with bortezomib (1-10 nM). Percentage of viable cells ± standard deviation are normalized with respect to DMSO-treated cells (vehicle) for each experimental condition. Statistical differences were assessed across all plots via Student t test; ∗ P < .05, ∗∗ P < .01, and ∗∗∗ P < .001.
Article Snippet: The human
Techniques: Functional Assay, Biomarker Discovery, Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Sequencing, CRISPR, Binding Assay, Transduction, Plasmid Preparation, Colony Assay, Generated, Microscopy, Standard Deviation
Journal: Blood
Article Title: An unbiased lncRNA dropout CRISPR-Cas9 screen reveals RP11-350G8.5 as a novel therapeutic target for multiple myeloma
doi: 10.1182/blood.2023021991
Figure Lengend Snippet: RP11-350G8.5 putative oncogenic role: in vitro validation and preliminary data from in vivo models. (A) Flow cytometric monitoring of GFP expression in ABZB cells transduced with a SCRAMBLE-GFP-CRISPR negative control vector, an RPL8 /KO-GFP-CRISPR positive control vector (selected from Project Score [37]), and 2 GFP-CRISPR constructs encoding for 2 pgRNAs targeting RP11-350G8.5. Gray curves represent the percentage of viable cells at day 0 (48 hours after lentiviral transduction), while colored curves represent the percentage of viable cells at day 20. Bars on the right represent the fold change in percentage of GFP-expressing cells 20 days after target depletion against day 0. (B) Evaluation of IL-6R RNA expression level through quantitative real time PCR (qRT-PCR) on ABZB after transduction with SCRAMBLE vector or KO of RP11-350G8.5 with pgRNA#1 or pgRNA#2 or with a vector overexpressing RP11-350G8.5 (UP). (Data are normalized to the expression of GAPDH.) Statistics were obtained using multiple t -tests, resulting in no significant (ns) differences, as per the reported P values. (C) Flow cytometric monitoring of GFP in JJN.3 and NCI-H929 MM transduced cells, and percentage of GFP-positive cells is reported by overlapping curves referred to day 20 (colored curves) against day 0 (light gray curves). (D) Validation of RP11-350G8.5 KO in nontumoral cells, performed as described for A and C. (E) Representative images of RNA-FISH analysis. Nuclei are counterstained with DAPI (blue signal), whereas C3-fluorescein–conjugated GAPDH (green signal) has been used as cytoplasmic marker. Customly designed Stellaris probes targeting RP11-350G8.5 have been conjugated with 5-carboxytetramethylrhodamine (TAMRA) dye (red signal). Representative pictures acquired with a DMI6000-AF6000 Leica (Wetzlar, Germany) fluorescence microscope at magnification ×63 are reported, followed by specific regions of interest (ROIs), which are represented as enlarged images. (F) Dose-response curves 24 hours after treatment with bortezomib in AMO-1 cells overexpressing RP11-350G8.5 (1-10 nM). Statistics were analyzed using multiple t -tests (cutoff ∗ P < .05, ∗∗ P < .01). (G) In vivo imaging of engrafted ABZB cells. A total of 5 × 10 6 ABZB cells, which previously underwent highly efficient transduction (multiplicity of infection = 1) of RP11-350G8.5 KO-GFP or the SCRAMBLE vectors, were subcutaneously inoculated in mice (n = 2 per group). Images of tumors were acquired when the tumoral masses became palpable (identified as DAY 1), and at the end of the experiment (DAY 16, when tumors reached 2 cm in diameter). Both DAY 1 and DAY 16 were set up by considering SCRAMBLE mice, because SCRAMBLE cells have been faster to generate tumoral masses, due to their higher proliferative rate, and to grow up to 2 cm in diameter, with respect to KO cells. Tumors appear as yellow high-density signals on the right flank of the mice. Pictures were obtained with the IVIS (Perkin Elmer) system. (H) Tumor growth as mean measurement ± standard deviation (SD) across mice groups (n = 2). (I) Photographs of excised tumors were captured by a digital camera. (J) Weights of excised tumors, reported as mean ± SD across mice groups. Statistics were analyzed using multiple t -tests (cutoff: ∗ P < .05).
Article Snippet: The human
Techniques: In Vitro, Biomarker Discovery, In Vivo, Expressing, Transduction, CRISPR, Negative Control, Plasmid Preparation, Positive Control, Construct, RNA Expression, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Marker, Fluorescence, Microscopy, In Vivo Imaging, Infection, Standard Deviation
Journal: Mediators of Inflammation
Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition
doi: 10.1155/2019/1625381
Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Article Snippet: The expression plasmid for expressing
Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control
Journal: Mediators of Inflammation
Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition
doi: 10.1155/2019/1625381
Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.
Article Snippet: The expression plasmid for expressing
Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression
Journal: Mediators of Inflammation
Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition
doi: 10.1155/2019/1625381
Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.
Article Snippet: The expression plasmid for expressing
Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control
Journal: Bone
Article Title: A role for G protein-coupled receptor 137b in bone remodeling in mouse and zebrafish
doi: 10.1016/j.bone.2019.06.002
Figure Lengend Snippet: (A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA lentivirus. (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Article Snippet:
Techniques: Transduction, Modification, Western Blot, Membrane, Expressing, Control, Staining, Activity Assay, Cell Culture, MANN-WHITNEY